anti-s. pyogenes polyclonal antibody  (GenScript corporation)

Journal: STAR Protocols

Article Title: Protocol for CRISPR-based manipulation and visualization of endogenous α-synuclein in cultured mouse hippocampal neurons

doi: 10.1016/j.xpro.2025.103945

Figure Lengend Snippet: Global and selective attenuation of α-syn in hippocampal cultures using CRISPR-Cas9 (A) Cultured neurons were transduced with lentiviruses (13,013 bp) or AAVs (7289 bp) carrying CRISPR-components (α-syn KO gRNA and Sp/SaCas9) to knockdown mouse α-syn, followed by western blots and immunostaining. A gRNA not targeting to any known sequence in the mouse genome [“Scramble (Scr) Control”] was used as controls. (B) Endogenous mouse α-syn was almost undetectable in lentiviral-transduced cultures using western blots, and the attenuation was selective for α-syn (gel and quantification on the right; ∗∗∗, p < 0.001 by Student’s t test; n = 3). (C) Representative images show marked attenuation of synaptic α-syn immunostaining in lentiviral-transduced α-syn KO-gRNA/SpCas9 treated neurons, with widespread (∼100%) transduction of SpCas9. (D) On target TIDE analysis of DNA from mouse hippocampal neurons treated with lentiviral-transduced α-syn KO/Cas9-gRNA (n = 2 samples). Note on-target deletions and insertions seen only with α-syn-gRNA/SpCas9. (E) Western blots from cultured neurons transduced with a single AAV carrying α-syn KO-gRNA and SaCas9 show marked attenuation of α-syn levels, quantified on the right (∗∗∗, p < 0.001 by Student’s t-test; n = 3).

Article Snippet: Note: For CRISPR KO experiments, use mouse monoclonal anti-α-synuclein antibody (Synaptic Systems, Cat#128211, RRID: AB_2619811 ) and rabbit polyclonal anti-SpCas9 antibody (Cell Signaling Technology, Cat#19526, RRID: AB_2798820 ); staining for SpCas9 is critical to assess AAV transduction efficiency and genome editing.

Techniques: CRISPR, Cell Culture, Transduction, Knockdown, Western Blot, Immunostaining, Sequencing, Control

Journal: STAR Protocols

Article Title: Protocol for CRISPR-based manipulation and visualization of endogenous α-synuclein in cultured mouse hippocampal neurons

doi: 10.1016/j.xpro.2025.103945

Figure Lengend Snippet: Endogenous tagging of α-syn in cultured neurons using CRISPR-Cas9 (A) KI strategy to insert a fluorescent tag oScarlet at the C-terminus of endogenous mouse α-syn. Note that two AAVs are used – the AAV α-syn:oScarlet KI donor and AAV-SpCas9. CRISPR KI targeting of the Snca 1 exon 6 locus was achieved using a sgRNA sequence (5′-AGGCTTCAGGCTCATAGTCT-3′) cloned into an AAV KI donor vector containing the oScarlet tag. Hippocampal neurons were transduced with the AAV, and genomic DNA was extracted at DIV 21. (B) PCR analysis was performed to validate the integration at the 5′ and 3′ junctions. For the 5′ junction, amplification was conducted using the α-syn forward primer (PCR#1): 5′ TGTGCTTTCTCTTCCCTCTCTG 3′ and oScarlet reverse primer: 5′ ACAGGATGTCCCAGGAGAAG 3’. For the 3′ junction, the α-syn forward primer (PCR#2): 5′ ATAACACTTCGTGCAGCACC 3′ and the same oScarlet reverse primer were used. Amplified products of approximately 500 bp confirm successful KI integration at both junctions. (C) Samples from CRISPR KI tagging (neuronal protein lysates) were analyzed by NuPAGE and immunoblotted with antibodies against α-syn, β-syn (CRISPR KI specificity control), VAMP2/Synapsin I (α-syn interacting proteins) and GAPDH as loading control. Note higher molecular-weight band corresponding to oScarlet-tagged α-syn. (D) Western blotting quantification for gels in (C); ∗∗, p < 0.001 by Student’s t test (n = 3). (E) Strategy for evaluating oScarlet-KI. The AAV α-syn:oScarlet KI donor only, or AAV SpCas9 only were used as controls. AAV transduced neurons were stained with vGlut1 (green) to identify synapses. (F) Representative images of cultured neurons expressing the KI construct (α-syn-KI donor/SpCas9), or controls. Note that neurons co-transduced with AAV α-syn:oScarlet KI donor/AAV SpCas9 show a punctate staining pattern that overlaps with a subset of synapses (top panels). However, no synaptic staining was seen with either the AAV α-syn:oScarlet KI donor only, or AAV SpCas9 alone. (G) Comparison of synaptic fluorescence intensity across all conditions. Notably, α-syn was endogenously tagged with oScarlet in approximately 53% of synapses (top). Minimal synaptic fluorescence was observed in control conditions using either the AAV α-syn:oScarlet KI donor alone or AAV SpCas9 alone (∗∗∗, p < 0.001 by Student’s t-test; AAV α-syn:oScarlet KI donor + AAV SpCas9: n = 106 synapses; AAV α-syn:oScarlet KI donor only: n = 68; AAV SpCas9 only: n = 6).

Article Snippet: Note: For CRISPR KO experiments, use mouse monoclonal anti-α-synuclein antibody (Synaptic Systems, Cat#128211, RRID: AB_2619811 ) and rabbit polyclonal anti-SpCas9 antibody (Cell Signaling Technology, Cat#19526, RRID: AB_2798820 ); staining for SpCas9 is critical to assess AAV transduction efficiency and genome editing.

Techniques: Cell Culture, CRISPR, Sequencing, Clone Assay, Plasmid Preparation, Transduction, Amplification, Control, Molecular Weight, Western Blot, Staining, Expressing, Construct, Comparison, Fluorescence